/* The Great Computer Language Shootout
   http://shootout.alioth.debian.org/

   contributed by Isaac Gouy
   optimizations by Alp Toker <alp@atoker.com>
*/

using System;
using System.IO;
using System.Text;

class Fasta
{
	static Fasta ()
	{
		ALU = Encoding.ASCII.GetBytes (ALUSTR);
	}

	static void Main (string[] args){
		MakeCumulative (HomoSapiens);
		MakeCumulative (IUB);

		int n = args.Length > 0 ? Int32.Parse (args[0]) : 1000;

		using (Stream s = Console.OpenStandardOutput ()) {
			MakeRepeatFasta ("ONE", "Homo sapiens alu", ALU, n*2, s);
			MakeRandomFasta ("TWO", "IUB ambiguity codes", IUB, n*3, s);
			MakeRandomFasta ("THREE", "Homo sapiens frequency", HomoSapiens, n*5, s);
		}
	}

	// The usual pseudo-random number generator

	const int IM = 139968;
	const int IA = 3877;
	const int IC = 29573;
	static int seed = 42;

	static double random (double max)
	{
		return max * ((seed = (seed * IA + IC) % IM) * (1.0 / IM));
	}

	// Weighted selection from alphabet

	static byte[] ALU;
	static string ALUSTR =
		"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
		"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
		"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
		"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
		"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
		"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
		"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";

	struct Frequency {
		public byte c;
		public double p;

		public Frequency (char c, double p) {
			this.c = (byte)c;
			this.p = p;
		}
	}

	static Frequency[] IUB = {
		new Frequency ('a', 0.27)
			,new Frequency ('c', 0.12)
			,new Frequency ('g', 0.12)
			,new Frequency ('t', 0.27)

			,new Frequency ('B', 0.02)
			,new Frequency ('D', 0.02)
			,new Frequency ('H', 0.02)
			,new Frequency ('K', 0.02)
			,new Frequency ('M', 0.02)
			,new Frequency ('N', 0.02)
			,new Frequency ('R', 0.02)
			,new Frequency ('S', 0.02)
			,new Frequency ('V', 0.02)
			,new Frequency ('W', 0.02)
			,new Frequency ('Y', 0.02)
	};

	static Frequency[] HomoSapiens = {
		new Frequency ('a', 0.3029549426680)
			,new Frequency ('c', 0.1979883004921)
			,new Frequency ('g', 0.1975473066391)
			,new Frequency ('t', 0.3015094502008)
	};

	static void MakeCumulative (Frequency[] a) {
		double cp = 0.0;
		for (int i=0; i < a.Length; i++){
			cp += a[i].p;
			a[i].p = cp;
		}
	}

	// naive
	static byte SelectRandom (Frequency[] a) {
		double r = random (1.0);

		for (int i=0 ; i < a.Length ; i++)
			if (r < a[i].p)
				return a[i].c;

		return a[a.Length-1].c;
	}

	const int LineLength = 60;
	const int BufferSize = 512;
	static int index = 0;
	static byte[] bbuffer = new byte[BufferSize];

	static void MakeRandomFasta (string id, string desc, Frequency[] a, int n, Stream s) {
		index = 0;
		int m = 0;

		byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n");
		s.Write (descStr, 0, descStr.Length);

		while (n > 0) {
			m = n < LineLength ? n : LineLength;

			if (BufferSize - index < m) {
				s.Write (bbuffer, 0, index);
				index = 0;
			}

			for (int i = 0 ; i < m ; i++) {
				bbuffer[index++] = SelectRandom (a);
			}

			bbuffer[index++] = (byte)'\n';
			n -= LineLength;
		}

		if (index != 0)
			s.Write (bbuffer, 0, index);
	}

	static void MakeRepeatFasta (string id, string desc, byte[] alu, int n, Stream s) {
		index = 0;
		int m = 0;
		int k = 0, kn = alu.Length;

		byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n");
		s.Write (descStr, 0, descStr.Length);

		while (n > 0) {
			m = n < LineLength ? n : LineLength;

			if (BufferSize - index < m) {
				s.Write (bbuffer, 0, index);
				index = 0;
			}

			for (int i = 0; i < m ; i++) {
				if (k == kn) k = 0;
				bbuffer[index++] = alu[k];
				k++;
			}

			bbuffer[index++] = (byte)'\n';
			n -= LineLength;
		}

		if (index != 0)
			s.Write (bbuffer, 0, index);
	}
}